Journal: BMC Cancer

Article Title: Performance of the colorectal cancer screening marker Sept9 is influenced by age, diabetes and arthritis: a nested case–control study

doi: 10.1186/s12885-015-1832-6

Figure Lengend Snippet: Age plotted against Sept9 outcome. FP: False positive, TN: True negative, FN: False negative, TP: True positive. N: Number of subjects in each category. Age: All ages younger or equal to the age interval mentioned. -1/3 and 2/3 refers to the PCR-algorithms used

Article Snippet: Samples were then analyzed for presence of methylated Sept9 DNA with the Sensitive PCR kit on a 7500 Fast Dx Real Time PCR device (Life Technologies).

Techniques:

Journal: BMC Cancer

Article Title: Performance of the colorectal cancer screening marker Sept9 is influenced by age, diabetes and arthritis: a nested case–control study

doi: 10.1186/s12885-015-1832-6

Figure Lengend Snippet: Sept9 positivity of individuals with CRC

Article Snippet: Samples were then analyzed for presence of methylated Sept9 DNA with the Sensitive PCR kit on a 7500 Fast Dx Real Time PCR device (Life Technologies).

Techniques: Clinical Proteomics

Journal: BMC Cancer

Article Title: Performance of the colorectal cancer screening marker Sept9 is influenced by age, diabetes and arthritis: a nested case–control study

doi: 10.1186/s12885-015-1832-6

Figure Lengend Snippet: Sept9 positivity of individuals with NED

Article Snippet: Samples were then analyzed for presence of methylated Sept9 DNA with the Sensitive PCR kit on a 7500 Fast Dx Real Time PCR device (Life Technologies).

Techniques: Clinical Proteomics

Journal: BMC Cancer

Article Title: Performance of the colorectal cancer screening marker Sept9 is influenced by age, diabetes and arthritis: a nested case–control study

doi: 10.1186/s12885-015-1832-6

Figure Lengend Snippet: Predictors of Colorectal Cancer, 1/3 algorithm

Article Snippet: Samples were then analyzed for presence of methylated Sept9 DNA with the Sensitive PCR kit on a 7500 Fast Dx Real Time PCR device (Life Technologies).

Techniques:

Journal: Frontiers in Oncology

Article Title: Urinary Markers in Bladder Cancer: An Update

doi: 10.3389/fonc.2018.00362

Figure Lengend Snippet: Urinary tumor-derived DNAs as biomarkers in BCs.

Article Snippet: , HS3ST2, SEPTIN9, SLIT2/FGFR3 , surveillance, low vs. high risk , ( ) .

Techniques: Biomarker Discovery, DNA Methylation Assay

Journal: PLoS Genetics

Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

doi: 10.1371/journal.pgen.1004160

Figure Lengend Snippet: Glucose-sensitive clonal INS-1 832/13 β-cells were used to study the impact of Cdkn1a, Pde7b, Sept9 and Exoc3l on insulin secretion and β-cell function. ( A ) Overexpression of Cdkn1a , Pde7b and Sept9 with pcDNA3.1 expression vectors in clonal β-cells resulted in elevated mRNA levels (black bars) compared with β-cells transfected with an empty pcDNA3.1 vector (white bars). * P <0.05. Data are mean ± SEM. Overexpression was also evident at the protein level as determined by immunoblot detection of the HA-tag situated on the c-terminal of the cloned cDNAs (rightmost panel) ( B ) Insulin secretion in response to 2.8 mM (white bars) and 16.7 mM (black bars) glucose in clonal β-cells overexpressing either Cdkn1a, Pde7b or Sept9 compared with control cells transfected with an empty pcDNA3.1 vector (n = 5). * P <0.05. Data are mean ± SEM ( C ) Decreased cell proliferation in clonal β-cells overexpressing Cdkn1a (black bar) compared with cells transfected with an empty pcDNA3.1 vector (white bar) (n = 4). * P <0.05. Data are mean ± SEM ( D ) Insulin secretion in response to 2.8 mM and 16.7 mM glucose (Gluc) or 16.7 mM glucose (Gluc) in combination with 100 µM IBMX in clonal β-cells overexpressing Pde7b (black bars) compared with cells transfected with an empty pcDNA3.1 vector (white bars) (n = 3). * P <0.05. NS = not significant. ( E ) Increased DNA methylation and decreased mRNA expression of EXOC3L2 in pancreatic islets of 15 T2D versus 34 non-diabetic donors. ( F ) Transfection of clonal β-cells with siRNA targeting Exoc3l resulted in decreased Exoc3l mRNA expression (siExo3l, black bar) when compared with clonal β-cells transfected with negative control siRNA (siNC, white bar) (n = 3). * P <0.05. Silencing of Exoc3l resulted in decreased Ca 2+ -dependent exocytosis; ( G ) Depolarizationevoked a decrease in membrane capacitance (ΔC m ) in single INS1-832/13 β-cells where Exoc3l was silenced (black trace) compared with control β-cells (grey trace) treated with negative control siRNA. ( H ) Histogram of the summed increase in membrane capacitance evoked by the two first depolarizations (Σ 1–2 ), the latter eight depolarizations (Σ 3–10 ) or all depolarizations in the train (Σ all ). Data are mean ± SEM of n = 11 β-cells treated with control siRNA (white bars) and n = 4 β-cells treated with siRNA against Exoc3l (black bars). * P <0.05. ( I ) Depolarization-evoked increase in current (I) in single INS1-832/13 β-cells treated with control siRNA (grey trace) or siRNA targeting Exoc3l (black trace). Notice that the rapid Na + -current is markedly diminished in siExoc3l treated clonal β-cells. ( J ) Reduced expression of Exoc3l has no effect on the Ca 2+ influx. Charge (Q)-voltage (V m ) relationship in β-cells treated with control (white squares) siRNA and siRNA against Exoc3l (black circles). The charge is representative of the Ca 2+ -influx into the cell through the voltage-dependent Ca 2+ channels. ( K ) As in J , but the peak-current (Ipeak)-voltage (Vm)-relationship was estimated as a representation of the voltage-dependent Na + current. The Na + current is significantly reduced in siExoc3l cells ( P <0.05) versus control siRNA cells except for the depolarization to −40 mV. Data in J and K are mean ± SEM of n = 11 β-cells treated with control siRNA and n = 7 siExoc3l treated β-cells. ( L ) αTC1-6 cells were used to determine the impact of Cdkn1a, Pde7b and Sept9 on glucagon secretion. Overexpression of Cdkn1a and Pde7b resulted in significantly increased glucagon secretion at 1 mM glucose (white bars) (n = 4, * P <0.05), while overexpression of Pde7b and Sept9 resulted in increased glucagon secretion at 16.7 mM glucose (black bars) (n = 4, ¤ P <0.05) compared with control cells transfected with an empty pcDNA3.1 vector.

Article Snippet: Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

Techniques: Cell Function Assay, Over Expression, Expressing, Transfection, Plasmid Preparation, Western Blot, Clone Assay, Control, DNA Methylation Assay, Negative Control, Membrane

Journal: PLoS Genetics

Article Title: Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

doi: 10.1371/journal.pgen.1004160

Figure Lengend Snippet: Technical validation of Infinium HumanMethylation450 BeadChip data using pyrosequencing.

Article Snippet: Overexpression was verified with real-time PCR using an ABI 7900 system (Applied Biosystems, Foster City, CA, USA) and a SYBR Green assay for Cdkn1a (fwd-primer: ATGTCCGACCTGTTCCACAC , rev-primer: CAGACGTAGTTGCCCTCCAG ) or TaqMan assays (Life Technologies) for Pde7b (Rn00590117_m1) and Sept9 (Rn00582942_m1).

Techniques: Biomarker Discovery